Stem-loop

Formation and Stability

The formation of a stem-loop structure is dependent on the stability of the resulting helix and loop regions. Obviously, the first prerequisite is the presence of a sequence that can fold back on itself to form a paired double helix. The stability of this helix is determined by its length, the number of mismatches or bulges it contains (a small number are tolerable, especially in a long helix), and the base composition of the paired region. Pairings between aromatic rings in a favorable orientation, also promote helix formation.

The stability of the loop also influences the formation of the stem-loop structure. "Loops" that are less than three bases long are sterically impossible and do not form. Large loops with no secondary structure of their own (such as pseudoknot pairing) are also unstable. Optimal loop length tends to be about 4-8 bases long. One common loop with the sequence UUCG is known as the "tetraloop" and is particularly stable due to the base-stacking interactions of its component nucleotides.

Structural contexts

Stem-loops occur in pre-pseudoknots, where the loop of one structure forms part of the second stem.

Many hammerhead ribozyme's basic secondary structure is required for self-cleavage activity.

Stem-loop structures are also important in prokaryotic RNA polymerase to become dissociated from the DNA template strand. This process is known as rho-independent or intrinsic termination, and the sequences involved are called terminator sequences.

Example

The palindromic DNA sequence

---CCTGCXXXXXXXGCAGG---

can form the following hairpin structure

---C G---
   C G
   T A
   G C
   C G
   X X
  X   X
   X X
    X

A longer example of a 3' sequence of RNA which would lead to a hairpin loop structure is:

GCCGCGGGCCGAAAAAACCCCCCCGGCCCGCGGC

See also

• Dyad symmetry
• Inverted repeat

References

• Watson JD, Baker TA, Bell SP, Gann A, Levine M, Losick R. (2004). Molecular Biology of the Gene. 5th ed. Pearson Benjamin Cummings: CSHL Press. See esp. ch. 6.